Endogenne peptydy przeciwdrobnoustrojowe i infekcje skóry w atopowym zapaleniu skóry czesc 4

Następnie błonę inkubowano w temperaturze pokojowej przez dwie godziny z kozim przeciwciałem przeciw-peroksydazą chrzanową (Dako) rozcieńczonym do 1: 4000 w roztworze blokującym. Odczynnik chemiluminescencyjny Western Lightning (Perkin-Elmer Life Sciences) został użyty do wykrycia elektro-chemiluminescencji. Do analizy densytometrycznej wykorzystano system obrazowania słabo oświetlonego (ChemiImager 4400, Alpha Innotech). Sygnał wykryty metodą analizy dot blot został potwierdzony w niektórych eksperymentach za pomocą analizy Western blot, która zidentyfikowała pełnej długości LL-37 przy 18 kD. W celu kwantyfikacji zarówno LL-37 jak i HBD-2, intensywność sygnału ekstraktów tkankowych była bezpośrednio porównywana z intensywnością równoczesnego przygotowania standardowego składającego się ze znanych ilości każdego syntetycznego peptydu. Stężenie peptydu przeciwdrobnoustrojowego w oryginalnej próbce skóry i biopsji oszacowano następnie dzieląc doświadczalnie określoną masę peptydu przeciwdrobnoustrojowego z próbki pobranej z biopsji skóry przez objętość naskórka. Objętość naskórka oszacowano przyjmując grubość naskórka 0,1 mm; w ten sposób objętość naskórka w 2-mm wycinanej próbce biopsyjnej wynosiła 3,14 × 10-1 mm3. RT-PCR Analiza RNA z HBD-2 i LL-37
Całkowity RNA wyizolowano z 2-mm próbek pobranych z biopsji skóry od pacjentów za pomocą odczynnika TRI (Sigma) zgodnie z protokołem producenta. Startery i sonda do HBD-2 zostały zaprojektowane przy użyciu oprogramowania do wykrywania sekwencji Prism 7700 (Primer Express, Perkin-Elmer Applied Biosystems). Sekwencjami starterów były 5 TCCTCTTCTCGTTCCTCTTCATATTC3 (starter do przodu) i 5 TTAAGGCAGGTAACAGGATCGC3 (starter odwrotny). Sekwencja dla sondy (TaqMan, Perkin-Elmer) była 5 ACCACAAAAACACCTGGAAGAGGCA3 ; koniec 5 znakowano 6-karboksyfluoresceiną, a koniec 3 znakowano 6-karboksytetrametylorododaminą.
Reakcje amplifikacji przeprowadzono za pomocą detektora sekwencji (ABI Prism 7700, Perkin-Elmer Applied Biosystems) w probówkach MicroAmp (Perkin-Elmer Applied Biosystems) w 25-.l mieszaninie zawierającej 8% glicerolu, 1x buforu TaqMan A ( 500 mM chlorek potasu, 100 mM TRIS-chlorowodór, 0,1 M EDTA i 600 nM pasywny barwnik referencyjny ROX, pH 8,3, w temperaturze pokojowej), 300 .M każdego trifosforanu deoksyadenozyny, trifosforan deoksyguanozyny i trifosforan deoksycytydyny, i 600 .M deoksyurydyny trifosforan; 5,5 mM chlorku magnezu; 900 nM przedni starter; 900 nM odwrotnego startera; 200 nM sonda; 0,625 U polimeru AmpliTaq Gold DNA (Perkin-Elmer); 6,25 U odwrotnej transkryptazy wirusa mysiej białaczki Moloneya (Life Technologies); 10 jil inhibitora rybonukleazy RNasin (Promega); i matrycowy RNA. Test RT przeprowadzono w 48 ° C przez 30 minut, a następnie aktywację TaqGold w 95 ° C przez 10 minut. Czterdzieści cykli amplifikacji przeprowadzono w 95 ° C przez 15 sekund i w 60 ° C przez minutę.
Po amplifikacji przeprowadzono akwizycję i analizę danych w czasie rzeczywistym. Dane fluorescencji wyrażono jako znormalizowany sygnał reporterowy, obliczony przez podzielenie ilości sygnału reporterowego przez ilość pasywnego sygnału odniesienia, lub jako zmianę w normalnym sygnale reportera, obliczoną jako ilość znormalizowanego sygnału reporterowego minus ilość sygnału reportera. przed PCR
[patrz też: ubm oka, gabinet psychologiczny wrocław, bardzo rzadkie choroby ]
[przypisy: endometrium proliferacyjne, przychodnia kickiego, sanvit iwonicz ]