Endogenne peptydy przeciwdrobnoustrojowe i infekcje skóry w atopowym zapaleniu skóry ad 5

Próg wykrywalności został ustawiony powyżej średniej wartości linii bazowej dla fluorescencji określonej na podstawie pierwszych 15 cykli. Reakcje amplifikacji, w których intensywność fluorescencji przekroczyła próg, określono jako reakcje pozytywne. Cykl progowy (Ct) to cykl PCR, w którym można najpierw wykryć wzrost sygnału reportera powyżej sygnału linii podstawowej. Standardową krzywą uzyskano przy użyciu danych fluorescencyjnych z 10-krotnych seryjnych rozcieńczeń całkowitego RNA z próbki pobranej z biopsji skóry od pacjenta z łuszczycą. Krzywa ta została wykorzystana do obliczenia względnych ilości HBD-2 w testowanych próbkach. Ilości HBD-2 w badanych próbkach normalizowano do odpowiedniego rybosomalnego RNA 18S (rRNA) (P / N 4308310, Perkin-Elmer Applied Biosystems). W czasie rzeczywistym, ilościowy test PCR dla LL-37 przeprowadzono przy użyciu systemu do wykrywania sekwencji (GeneAmp 5700, Perkin-Elmer). Klasyczne primery 18S (Ambion) zastosowano do amplifikacji rRNA 18S. Sekwencje starterów stosowane do amplifikacji komplementarnego DNA LL-37 (cDNA) to 5 GCAGTCACCAGAGGATTGTGAC3 (starter przedni) i 5 CACCGCTTCACCAGCCC3 (starter odwrotny). Do testu PCR LL-37 zastosowano 1,2 .l RT reakcji; 1,2 .l 200-krotnej rozcieńczonej reakcji RT zastosowano do PCR 18S rRNA. Reakcje amplifikacji przeprowadzono w końcowej objętości całkowitej 25,7 .l zawierającej SYBR Green PCR Master Mix (Applied Biosystems), 10 .M primer i wodę wolną od nukleaz. Test przeprowadzono w 50 ° C przez 2 minuty i w 95 ° C przez 10 minut. Następnie przeprowadzono czterdzieści cykli amplifikacji w 94 ° C przez 15 sekund i w 60 ° C przez minutę. Wyniki analizowano za pomocą porównawczej metody Ct. Metoda ta opiera się na założeniu, że startery docelowe (LL-37) i referencyjne (18S) amplifikują z taką samą wydajnością w danym zakresie początkowych stężeń informacyjnego RNA (mRNA). Aby przetestować to założenie, cDNA wytworzono z całkowitego RNA próbki łuszczycy przy początkowych całkowitych stężeniach RNA wynoszących 1000, 500, 100, 50 i 10 ng. PCR w czasie rzeczywistym przeprowadzono w trzech powtórzeniach dla każdego wyjściowego stężenia i obliczono zmianę w Ct (.Ct). Dla każdego wyjściowego stężenia całkowitego RNA, .Ct = CtR – CtG, gdzie CtR oznacza odniesienie Ct i CtG docelowego Ct. Ta wartość została wykreślona w stosunku do log początkowego całkowitego stężenia RNA. Wydajność amplifikacji genu była na tyle duża, że współczynnik korekcji w określonym zakresie nie był wymagany, jeśli nachylenie było mniejsze lub równe 0,1. Obliczyliśmy Ct dla próbek w następujący sposób: Ct = .CtE – .CtB, gdzie CtE oznacza doświadczalne Ct i CtB bazowe Ct. Próbka linii podstawowej była normalną próbką kontrolną, która miała niską ekspresję mRNA LL-37. Względną ekspresję obliczono jako 2Ct w celu uwzględnienia wykładniczej amplifikacji reakcji PCR.
Hodowlę komórkową
Komórki HaCat, ludzka linia komórkowa keratynocytów, hodowano w pożywce Dulbecco s Modified Eagle (Cellgro), uzupełnionej 10 procentami surowicy płodowej (Gemini) i procent każdego z następujących: 200 mM L-glutaminy, minimalnego podstawowego pożywki ( MEM) z nieistotnymi aminokwasami (GIBCO), MEM Vitamins Solution (Life Technologies) i penicyliną-streptomycyną
[patrz też: dyżury aptek sztum, rezonans otwarty, poradnia zaburzeń rytmu serca ]
[patrz też: żyła odpiszczelowa, tadeusz chowaniak, wazektomia opinie ]